Search
CSV
RISDetermination of sex ratio in bovine semen by quantitative Syber greeb real time PCR
requires reliable procedures,
therefore real time PCR assay can determinate sex ratio as
reliable assay. In this study a SYBR Green real time PCR
assay was used to determinate sex ratio in bovine sperm. Two
primers were designed...
Rapid identification of Bactrocera zonata (Dip.: Tephritidae) using TaqMan real-time PCR assay
insects and
purified DNA, we note added efficiency by eliminating DNA extraction step. Considering the
speed, specificity as well as sensitivity of the assay, Taqman real-time PCR can be used as a
swift and specific method for pest...
Effect of supplemented diet by sucrose or starch on fungi populations in rumen fluid as determined by real time polymerase chain reaction in Holstein steers.
.
Fungi rDNA concentrations were measured by real time PCR relative to
total bacteria amplification (ΔΔCt). The 16s rRNA gene-targeted primer
sets used in the present study were forward: GAGGAAGTAAAAGTCGTAACAAGGTTTC
and reverse...
Analysis of Chalcone Synthase and Chalcone Isomerase Gene Expression in Pigment Production Pathway at Different Flower Colors of Petunia Hybrida
Variegation in flower color is commonly observed in many plant species and also occurs on petunia (Petunia hybrida) as an ornamental plant. Variegated plants are highly valuable in the floricultural market. To gain a global ...
Irrigation effects on pds and bch genes expression of the Iranian Saffron
of bch and pds genes. Semi-quantitative RT-PCR showed no significant difference in the expression levels of genes of interest related to the internal standard (18S rRNA). Results of Real-Time PCR assays showed that the expression of bch and pds genes were...